cstf2

Ensembl ID:
ENSDARG00000044009
ZFIN ID:
ZDB-GENE-031118-2
Description:
cleavage stimulation factor subunit 2 [Source:RefSeq peptide;Acc:NP_956408]
Human Orthologues:
CSTF2, CSTF2T
Human Descriptions:
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Source:HGNC Symbol;Acc:2484]
cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant [Source:HGNC Symbol;Acc:17086
Mouse Orthologues:
Cstf2, Cstf2t
Mouse Descriptions:
cleavage stimulation factor, 3' pre-RNA subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1343054]
cleavage stimulation factor, 3' pre-RNA subunit 2, tau Gene [Source:MGI Symbol;Acc:MGI:1932622]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056627 Nonsense 160 488 5 14
ENSDART00000064612   None 339 None 12
ENSDART00000140625   None 196 None 6
Genomic Location (Zv9):
Chromosome 14 (position 42856822)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41014606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTTTGTTTCAATCATCCTATTTTTGGTTGGTTGTACAGCTATGTGTG[C/T]AGAACAGTCCTCAGGAGGCCAGGAACATGCTCCTCCAGAACCCTCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link