Q7SZD0_DANRE

Ensembl ID:
ENSDARG00000044002
Description:
LOC402847 protein [Source:UniProtKB/TrEMBL;Acc:Q7SZD0]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3304 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa3304
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064586 Essential Splice Site 138 521 2 9
Genomic Location (Zv9):
Chromosome 25 (position 17735051)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17281892
KASP Assay ID:
554-2933.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGGACGACCTCAAGACTTAATGATCAGTCATCTTACTGGGAATAAAG[G/A]TATAACTCCTATTAGGGGCGTAGCAACCGGGGGGATGGGGGACATACGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link