setd6

Ensembl ID:
ENSDARG00000043986
ZFIN ID:
ZDB-GENE-030131-1067
Description:
SET domain-containing protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q803K4]
Human Orthologue:
SETD6
Human Description:
SET domain containing 6 [Source:HGNC Symbol;Acc:26116]
Mouse Orthologue:
Setd6
Mouse Description:
SET domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913333]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1825 Essential Splice Site Available for shipment Available now
sa38042 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064573 Essential Splice Site 9 460 1 9

The following transcripts of ENSDARG00000043986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17713698)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17260539
KASP Assay ID:
554-1817.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGGTTTGCGTTTTAAAGAAATGGCGACGGAAGCAAAAAGACCAAAGG[T/C]AAGTTANNNNNGATTTTTTCTTAAGTTGTCAGTATAGTGACAGTTCACAAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064573 Essential Splice Site 133 460 None 9

The following transcripts of ENSDARG00000043986 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17712129)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17258970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCTCTTTGGCCAGATTTTAGGACTCTGGATCAACCCATGTTCTGG[T/C]GAGACCTTTCAGATATCCTTCACGGATCCTACTGATTATTATGGTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link