si:busm1-189a20.4

Ensembl ID:
ENSDARG00000043973
ZFIN ID:
ZDB-GENE-030131-9559
Description:
zinc finger protein 292 [Source:RefSeq peptide;Acc:NP_001025383]
Human Orthologue:
ZNF292
Human Description:
zinc finger protein 292 [Source:HGNC Symbol;Acc:18410]
Mouse Orthologue:
Zfp292
Mouse Description:
zinc finger protein 292 Gene [Source:MGI Symbol;Acc:MGI:1353423]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23613 Nonsense Available for shipment Available now
sa23612 Nonsense Available for shipment Available now
sa12684 Nonsense Available for shipment Available now
sa1811 Missense F2 line generated During 2017
sa18668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 124 2620 3 8
Genomic Location (Zv9):
Chromosome 20 (position 228063)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 218658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCAGAGCTGCTGCTTTCTCTGCCGCGGAATATCCCAGATGCATTGTG[G/A]GACAGGTTTAGGACATCCGTCCAGGTACATTTAGCAGGCTGTCTCTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 333 2620 7 8
Genomic Location (Zv9):
Chromosome 20 (position 225037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 215632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGATGTCGTTCCTGTCTAAAACTGTGTTCCACCTACTCTTCTTCATT[A/T]AATTCATCCAAACAGAGGTGAGCTGTGCCTGTTCACACTTACAGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 1030 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 222594)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 213189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGTCTCACTGGGTCAGATGCTTCCYCCCGTTTCTCAGACACTTCCTT[T/A]GCAAATGGCTTCCGTACCAAACGAKGGACAAGTTTTGGAAAACAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1811
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Missense 2209 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 219058)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 209653
KASP Assay ID:
554-1803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTGGAAGTACATCCGCCACGTTGACAAAAAGCATAAAGAAACCCAG[C/T]TCTCAAAGGTTAACGCTGTGGCGGGGGTGTTCAGATGTCCGATGGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104790 Nonsense 2349 2620 8 8
Genomic Location (Zv9):
Chromosome 20 (position 218636)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 209231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGTTGTGAAACGGTGACGAGTTCAGAGMGAAATATAATGAAGCATTA[T/A]CTWCAGCATGGCCTCCCAAAACARYAYTYGRAAGAACAGAGAAGCAACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link