lrpprc

Ensembl ID:
ENSDARG00000043970
ZFIN ID:
ZDB-GENE-030131-7887
Description:
leucine-rich PPR-motif containing [Source:RefSeq peptide;Acc:NP_001136064]
Human Orthologue:
LRPPRC
Human Description:
leucine-rich PPR-motif containing [Source:HGNC Symbol;Acc:15714]
Mouse Orthologue:
Lrpprc
Mouse Description:
leucine-rich PPR-motif containing Gene [Source:MGI Symbol;Acc:MGI:1919666]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17469 Nonsense Available for shipment Available now
sa22236 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42148 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35428 Nonsense Mutation detected in F1 DNA During 2016
sa22237 Nonsense Mutation detected in F1 DNA During 2016
sa12060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Nonsense 409 1461 9 38
ENSDART00000126427 Nonsense 395 1447 9 38
ENSDART00000128868 Nonsense 384 795 9 23
Genomic Location (Zv9):
Chromosome 13 (position 10375319)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10677648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTCATGAAAAGACTGCCTTTTCKGTGCTGAAAAGCTWAACCGGGATGT[T/A]AGAYACACATMCGGGTGACACTCCAGATTTTGGMAACTTCTTTCTTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Essential Splice Site 543 1461 12 38
ENSDART00000126427 Essential Splice Site 529 1447 12 38
ENSDART00000128868 Essential Splice Site 518 795 12 23
Genomic Location (Zv9):
Chromosome 13 (position 10389397)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10691726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCTGCCGTCTTTTCCATCATTGGACAATGCTAAGGCTTCTCTTAAGG[T/G]AACTGTACTGGATATGTGAATACATTGTTGGTTTATGTGACTGATTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Essential Splice Site 745 1461 20 38
ENSDART00000126427 Essential Splice Site 731 1447 20 38
ENSDART00000128868 Essential Splice Site 720 795 20 23
Genomic Location (Zv9):
Chromosome 13 (position 10405284)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10707613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCATTTAACCCTCAAAAAACTCATCAACGTCCTGAGTATTGAGGAG[G/T]TGAGGTTGATTCTTGTATCACTATCAATGTGTGCTGTTCGTGTTCAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Nonsense 757 1461 21 38
ENSDART00000126427 Nonsense 743 1447 21 38
ENSDART00000128868 Nonsense 732 795 21 23
Genomic Location (Zv9):
Chromosome 13 (position 10406700)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10709029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTGTTTTCAGAAACTGGAGCAAGCTCTCGATCTGAAATCTAAATA[T/A]GAGGATGACATGACGCCTGCTGCTTATGCCACTCTCATCAATCTGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Nonsense 1339 1461 35 38
ENSDART00000126427 Nonsense 1325 1447 35 38
ENSDART00000128868   None 795 None 23
Genomic Location (Zv9):
Chromosome 13 (position 10475616)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10777945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGAGAGTTTTGAGGTCTCTTGTGTTTCTCTGATTGCTTTAGCGCTG[T/A]GCGGCTGTCGGCGAGCAGAAGGACTTACTGTTCTCCTATGTGTTACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034230 Nonsense 1355 1461 35 38
ENSDART00000126427 Nonsense 1341 1447 35 38
ENSDART00000128868   None 795 None 23
Genomic Location (Zv9):
Chromosome 13 (position 10475662)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10777991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGCKGCTGTCGGCGAGCAGAAGGACTTACTGTTCTCCTATGTGTTA[C/T]GAGCGTCCCAGCAGCCCGGACAGGTAAACAGAAGCTGTTTGTTTTTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link