si:ch211-241j12.3

Ensembl ID:
ENSDARG00000043963
ZFIN ID:
ZDB-GENE-040724-72
Description:
actin-like [Source:RefSeq peptide;Acc:NP_001025380]
Human Orthologues:
AC078802.1, ACTL7A, ACTL7B, ACTL9, ACTRT1, ACTRT2
Human Descriptions:
actin-like 7A [Source:HGNC Symbol;Acc:161]
actin-like 7B [Source:HGNC Symbol;Acc:162]
actin-like 9 [Source:HGNC Symbol;Acc:28494]
Actin-related protein M1 [Source:UniProtKB/Swiss-Prot;Acc:Q9BYD9]
actin-related protein T1 [Source:HGNC Symbol;Acc:24027]
actin-related protein T2 [Source:HGNC Symbol;Acc:24026]
Mouse Orthologues:
4921517D21Rik, Actl7a, Actl7b, Actrt1, Actrt2, Arpm1, Gm498
Mouse Descriptions:
actin related protein M1 Gene [Source:MGI Symbol;Acc:MGI:1923902]
actin-like 7a Gene [Source:MGI Symbol;Acc:MGI:1343051]
actin-like 7b Gene [Source:MGI Symbol;Acc:MGI:1343053]
actin-related protein T1 Gene [Source:MGI Symbol;Acc:MGI:1920610]
actin-related protein T2 Gene [Source:MGI Symbol;Acc:MGI:1920603]
predicted gene 498 Gene [Source:MGI Symbol;Acc:MGI:2685344]
RIKEN cDNA 4921517D21 gene Gene [Source:MGI Symbol;Acc:MGI:1914972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19222 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064546   None 372 None 7
ENSDART00000123860 Nonsense 19 1239 1 12
Genomic Location (Zv9):
Chromosome 20 (position 191621)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 182216
KASP Assay ID:
2261-3793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGAGGAGGATCCTGACCGCTCCTGGTGCCGTTCCCCTCCAAGACCTC[C/T]AGCTGGCCCTTCAGTGGCAGTACGAGTACCTGAAGGGCCACCGCTCGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Meta-analysis of genome-wide association studies identifies three new risk loci for atopic dermatitis. (View Study)
  • Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link