pcdh10

Ensembl ID:
ENSDARG00000043961

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41642 Nonsense Mutation detected in F1 DNA During 2017
sa24867 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019005 Nonsense 26 966 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21593040)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21554454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTAACCTGCCTGGCGCTCATCGCATCTCTGATGGATGTAGTTCTGGCA[C/T]AGATTCGTTACACGATCCCCGAGGAACTGGAGCACGGGGCATTTGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019005 Nonsense 317 966 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21593913)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21555327
KASP Assay ID:
554-7729.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGGGACTTATAGATTATGAAAAGGCACGAATGCATGAGATTTACGTG[C/T]AAGCCAAAGACAAGGGACCGTCCGCTGTAGCGGTGCACTGCAAAGTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link