lrrc57

Ensembl ID:
ENSDARG00000043938
ZFIN ID:
ZDB-GENE-040718-372
Description:
Leucine-rich repeat-containing protein 57 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHL5]
Human Orthologue:
LRRC57
Human Description:
leucine rich repeat containing 57 [Source:HGNC Symbol;Acc:26719]
Mouse Orthologue:
Lrrc57
Mouse Description:
leucine rich repeat containing 57 Gene [Source:MGI Symbol;Acc:MGI:1913856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4700 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064515 Essential Splice Site 164 238 None 6
ENSDART00000114270 Essential Splice Site 164 238 None 5
ENSDART00000145054 Essential Splice Site 164 224 None 5
Genomic Location:
Chromosome 17 (position 12606205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGTGCARTGTCAGGGTGATCATTTTGTGCTGTGTTCATTCTGTTTC[A/T]GATTTCAAGCGTGACTCAAGAGGTGTCTCGCACAYCCAGACTGAAAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c5gdlzoo