si:ch211-241p10.1

Ensembl ID:
ENSDARG00000043912
ZFIN ID:
ZDB-GENE-040724-211
Description:
UPF0623 protein [Source:UniProtKB/Swiss-Prot;Acc:Q5PNP6]
Mouse Orthologue:
Mei4
Mouse Description:
meiosis-specific, MEI4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1922283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1540 Nonsense F2 line generated During 2017
sa36932 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1540
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064483 Nonsense 191 366 3 5
ENSDART00000137135 Nonsense 188 363 3 5
ENSDART00000148301 Nonsense 112 151 2 2
Genomic Location (Zv9):
Chromosome 20 (position 839260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 795125
KASP Assay ID:
554-1463.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCTGCTGGATTGTGTGGTGGAGGACTTCAGGCAGGCGCACACTGGA[C/T]AGCCTTTACGTCACCCAGAGCAGCTGCATAACGCCATTCAGGTGGTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064483 Nonsense 208 366 3 5
ENSDART00000137135 Nonsense 205 363 3 5
ENSDART00000148301 Nonsense 129 151 2 2
Genomic Location (Zv9):
Chromosome 20 (position 839311)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 795176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTTTACGTCACCCAGAGCAGCTGCATAACGCCATTCAGGTGGTGGCA[C/T]AGACCCTGAGTCCAGGAGGAGCACGCCAGGGGTTTCCAGTGCAGCACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link