gabrr1

Ensembl ID:
ENSDARG00000043902
ZFIN ID:
ZDB-GENE-040724-212
Description:
gamma-aminobutyric acid (GABA) receptor, rho 1 [Source:RefSeq peptide;Acc:NP_001020724]
Human Orthologue:
GABRR1
Human Description:
gamma-aminobutyric acid (GABA) receptor, rho 1 [Source:HGNC Symbol;Acc:4090]
Mouse Orthologue:
Gabrr1
Mouse Description:
gamma-aminobutyric acid (GABA) C receptor, subunit rho 1 Gene [Source:MGI Symbol;Acc:MGI:95625]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012376 Nonsense 398 466 10 10
Genomic Location (Zv9):
Chromosome 20 (position 1155608)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1111473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGAGCAGCAGCTACAGTGAGATGGACATGATGACCACGGGAAACTA[C/A]GGCATGTCGGAGCTGAGCGACACCAAGCAGGAGCAGTTCCTGGTTCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link