si:ch211-214k5.3

Ensembl ID:
ENSDARG00000043894
ZFIN IDs:
ZDB-GENE-041210-206, ZDB-GENE-041210-206
Description:
Novel protein similar to vertebrate CD209 antigen (CD209) [Source:UniProtKB/TrEMBL;Acc:Q5RGH7]
Human Orthologues:
CD207, CD209, CLEC4F, CLEC4M, FCER2
Human Descriptions:
C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
CD209 molecule [Source:HGNC Symbol;Acc:1641]
Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
Mouse Orthologues:
Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
Mouse Descriptions:
C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21735 Nonsense Available for shipment Available now
sa27611 Nonsense Mutation detected in F1 DNA During 2017
sa27612 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037303 Nonsense 37 222 1 6
ENSDART00000064459 Nonsense 54 230 2 5
ENSDART00000130402 Nonsense 76 236 2 5
Genomic Location (Zv9):
Chromosome 10 (position 25743400)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24967941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCTGTGTTTTCTTCTACTGACTGCAGTCATAGTGCTGAGCGTCTA[C/A]ACCCATACAAACTACACACAAGAGAACAGAATTACAAGCCTCACAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037303 Nonsense 84 222 1 6
ENSDART00000064459 Nonsense 101 230 2 5
ENSDART00000130402   None 236 None 5
Genomic Location (Zv9):
Chromosome 10 (position 25743539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24967802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGAGACCAACTACTAATCAATATCAATGCTGGGAATGCTCAGAAC[C/T]AAAACTTGACAAAAGAAAAGAATGAATTATTATCTAAGAATGATGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037303 Essential Splice Site 148 222 None 6
ENSDART00000064459 Essential Splice Site 156 230 None 5
ENSDART00000130402 Essential Splice Site 162 236 None 5
Genomic Location (Zv9):
Chromosome 10 (position 25743873)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24967468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGACAGAGGAGCAGATCTGATCATCATAAACAACAAAGAAGAACAAG[T/A]GAGTGAAAAACTCTCTCTCCCCCTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link