paf1

Ensembl ID:
ENSDARG00000043886
ZFIN ID:
ZDB-GENE-050506-101
Description:
RNA polymerase II-associated factor 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q4U0S5]
Human Orthologue:
PAF1
Human Description:
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25459]
Mouse Orthologue:
Paf1
Mouse Description:
Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22734 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064444 Essential Splice Site 297 406 10 11
Genomic Location (Zv9):
Chromosome 15 (position 46583982)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46788887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAGAGGAGGAGCTGGACCTGGAGAAGGACATGCAGGAGGACTCGGG[T/G]AACACACATTCTACCAGTTTCTGTTAGTCATTATAGTTGTCTGTATAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link