nup43

Ensembl ID:
ENSDARG00000043884
ZFIN ID:
ZDB-GENE-040426-2533
Description:
nucleoporin Nup43 [Source:RefSeq peptide;Acc:NP_998057]
Human Orthologue:
NUP43
Human Description:
nucleoporin 43kDa [Source:HGNC Symbol;Acc:21182]
Mouse Orthologue:
Nup43
Mouse Description:
nucleoporin 43 Gene [Source:MGI Symbol;Acc:MGI:1917162]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23620 Nonsense Available for shipment Available now
sa36935 Essential Splice Site Available for shipment Available now
sa23621 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064439 Nonsense 192 372 5 8
Genomic Location (Zv9):
Chromosome 20 (position 1347680)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1303545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGACTGAAGTTCTGACTGTGAACTCCATCGGTCAGCTGAAGATGTG[G/A]GACTTCAGACAGCAGAGTGACAGTCCTGCGCAGATTCTCTCACTGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064439 Essential Splice Site 207 372 5 8
Genomic Location (Zv9):
Chromosome 20 (position 1347726)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1303591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGGACTTCAGACAGCAGAGTGACAGTCCTGCGCAGATTCTCTCACTG[T/A]ATGTTTTATTTACTCCTATTATCTTTAAAATAGGCTTATGACATATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064439 Essential Splice Site 297 372 7 8
Genomic Location (Zv9):
Chromosome 20 (position 1350393)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1306258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACACTGGGAGAGCACTTCAGGATCAGACGTGAGCACACTTCTACAGAG[T/A]AAGCAATGATTTCGCTGCACACTTACGAAAAATAATATGTAGAATAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link