arid4a

Ensembl ID:
ENSDARG00000043873
ZFIN ID:
ZDB-GENE-050809-105
Description:
AT-rich interactive domain-containing protein 4A [Source:RefSeq peptide;Acc:NP_001026838]
Human Orthologue:
ARID4A
Human Description:
AT rich interactive domain 4A (RBP1-like) [Source:HGNC Symbol;Acc:9885]
Mouse Orthologue:
Arid4a
Mouse Description:
AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI Symbol;Acc:MGI:2444354]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15044 Essential Splice Site Available for shipment Available now
sa23011 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064412 Essential Splice Site 753 1196 20 21
ENSDART00000103228 None None 671 None 18
ENSDART00000121564 None None 663 None 20
ENSDART00000128291 Essential Splice Site 753 1332 19 24
Genomic Location:
Chromosome 17 (position 11257040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACAAGRAGAACTTCCGGGATGTATGATTCTGATAGAGGATCTAATGG[T/A]AMGAGCTGCTTGCATCAGAAWRGCACTAATAAAAATCCAAGCACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064412 Nonsense 1006 1196 21 21
ENSDART00000103228 None None 671 None 18
ENSDART00000121564 None None 663 None 20
ENSDART00000128291 Nonsense 1006 1332 20 24
Genomic Location:
Chromosome 17 (position 11255672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCCTTCTCTTACCAGAGAGGTGCACCTCAAGTTAGAAGCTCCTTG[T/A]CCAGACCTGGAGGATCCAACAACAGTGGCAAACGAGGAAATGATGCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5nomryll