nptnb

Ensembl ID:
ENSDARG00000043864
ZFIN ID:
ZDB-GENE-040426-1821
Description:
neuroplastin [Source:RefSeq peptide;Acc:NP_991268]
Human Orthologue:
NPTN
Human Description:
neuroplastin [Source:HGNC Symbol;Acc:17867]
Mouse Orthologue:
Nptn
Mouse Description:
neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43023 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31019 Essential Splice Site Mutation detected in F1 DNA During 2017
sa162 Nonsense Confirmed mutation in F2 line During 2017
sa1762 Nonsense Available for shipment Available now
sa12048 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064403 Essential Splice Site 28 403 1 9
ENSDART00000143245   None 196 None 6
ENSDART00000064403 Essential Splice Site 28 403 1 9
ENSDART00000143245   None 196 None 6
Genomic Location (Zv9):
Chromosome 18 (position 1028392)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1577283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGTCCACGGGAACGTGATGCTCCCGTACGTCTCCTCTCAGAACGG[T/A]AAGATGACGGGACGGGATCTCTGTGTGTGTATGTGTGTGTGTGTGTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064403 Essential Splice Site 28 403 1 9
ENSDART00000143245   None 196 None 6
ENSDART00000064403 Essential Splice Site 28 403 1 9
ENSDART00000143245   None 196 None 6
Genomic Location (Zv9):
Chromosome 18 (position 1028392)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1577283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGTCCACGGGAACGTGATGCTCCCGTACGTCTCCTCTCAGAACGG[T/A]AAGATGACGGGACGGGATCTCTGTGTGTGTATGTGTGTGTGTGTGTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa162
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064403 Nonsense 63 403 2 9
ENSDART00000143245   None 196 None 6
Genomic Location (Zv9):
Chromosome 18 (position 997008)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1304845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTACTGTGACGTGGTGGGGAACCCGGTGCCGGAGATCCAATGGTGGTA[C/G]GCCGATATAAACCGCGCAGACTCCTTCAAGCAGCTGTGGGACGGGGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064403 Nonsense 228 403 4 9
ENSDART00000143245 Nonsense 21 196 1 6
Genomic Location (Zv9):
Chromosome 18 (position 985400)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1293337
KASP Assay ID:
554-1755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAGGACTGATGATTCTGGAGAGTACATGTGTGTTTACACCTTTAAAT[C/A]GGCACCCAATGCCAATGCTTCCATTGAGGTCAAAGGTAAGAGACGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064403 Essential Splice Site None 403 None 9
ENSDART00000143245 Essential Splice Site None 196 None 6
Genomic Location (Zv9):
Chromosome 18 (position 961381)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1269318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCGGAACACCAATTGACCAATGGACCAACACAGAGCAATGCTGAAGG[T/C]TTACAATCATACTCAATCTGCTTTTCTAAACSRCCAMGCAAACATAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link