LOC100329589

Ensembl ID:
ENSDARG00000043852
Human Orthologue:
EPHB1
Human Description:
EPH receptor B1 [Source:HGNC Symbol;Acc:3392]
Mouse Orthologue:
Ephb1
Mouse Description:
Eph receptor B1 Gene [Source:MGI Symbol;Acc:MGI:1096337]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44398 Nonsense Mutation detected in F1 DNA During 2017
sa44399 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44400 Nonsense Mutation detected in F1 DNA During 2017
sa39506 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064388 Nonsense 63 355 1 8
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 1163)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 1163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGACAGTTCGATCATGCCAACATCCTGCGTCTGGAGGGGGTCATCACC[A/T]GAGGTCAGAGCACACACAAACACTATGCATTGCATAGGTTTACATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064388 Essential Splice Site 64 355 1 8
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 1168)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 1168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCGATCATGCCAACATCCTGCGTCTGGAGGGGGTCATCACCAGAGG[T/C]CAGAGCACACACAAACACTATGCATTGCATAGGTTTACATTGTTTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064388 Nonsense 84 355 3 8
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 2900)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 2900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACTATGATGATCGTGGTGGAGAGCATGGTGAACGGAGCGCTGGACT[C/A]GTTCCTGCGGGTGAGAGAATCTGTGTGGTTTTTCTGACTCAGCGGACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064388 Nonsense 136 355 4 8
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 5097)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 5097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGCGGCTGGCGGCTCATAAAGTGCTGGTCAACAGCAGTCTGGTCTGC[A/T]AAGTGTCCGGCTTCAGACCGCTGCAGGACGACAAGATCGAGGCCGTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link