PREP (2 of 3)

Ensembl ID:
ENSDARG00000043851
Description:
prolyl endopeptidase [Source:HGNC Symbol;Acc:9358]
Human Orthologue:
PREP
Human Description:
prolyl endopeptidase [Source:HGNC Symbol;Acc:9358]
Mouse Orthologue:
Prep
Mouse Description:
prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24819 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24818 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064387 Essential Splice Site 53 276 2 6
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 29506)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 29506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTACGGTTACGGAGGATTCGAGCACTCCATTCAGCCGCACTATAA[G/A]TTAGTATCAAGCACAGAGTGTGTTTCAGTAAAGAAGAGAGAATAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064387 Essential Splice Site 84 276 3 6
Genomic Location (Zv9):
Chromosome Zv9_NA135 (position 29306)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149753.1 29306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCCAACATTAGAGGAGGAGGAGAATACGGCCAGACCTGGCACAAAG[G/A]TGAGTACAGTTTAACACACACACACACACTCAAACACACTAACAGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link