ftr54

Ensembl ID:
ENSDARG00000043850
ZFIN ID:
ZDB-GENE-070620-19
Description:
Zgc:165577 protein [Source:UniProtKB/TrEMBL;Acc:A5PLE6]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3757 Nonsense Mutation detected in F1 DNA During 2014
sa21741 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 217 445 2 4
Genomic Location:
Chromosome 10 (position 26456512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCACCTGAAACGGTCAGCTTTGAGTTTGGTGCTCGTTCTTCTGCTGCT[A/T]GAAAAACCTTTTCTAAGAGACTAAAGAAAAAAATGGATGMTTTCCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 247 445 3 4
Genomic Location:
Chromosome 10 (position 26456318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAGATTAAACTAAATATAAGTTGTCCTCTCTTTAGTAAAGCGCTAC[A/T]AAAGTCCAACTGATGGGCCCAGGAACCGGAATGAGATCCTGCAATGTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2osk8a9s