ftr54

Ensembl ID:
ENSDARG00000043850
ZFIN ID:
ZDB-GENE-070620-19
Description:
Zgc:165577 protein [Source:UniProtKB/TrEMBL;Acc:A5PLE6]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3757 Nonsense Mutation detected in F1 DNA During 2016
sa34912 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21741 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 217 445 2 4
Genomic Location:
Chromosome 10 (position 26456512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCACCTGAAACGGTCAGCTTTGAGTTTGGTGCTCGTTCTTCTGCTGCT[A/T]GAAAAACCTTTTCTAAGAGACTAAAGAAAAAAATGGATGMTTTCCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Essential Splice Site 243 445 3 4
Genomic Location:
Chromosome 10 (position 26456330)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTTTACATGCAGATTAAACTAAATATAAGTTGTCCTCTCTTTA[G/A]TAAAGCGCTACAAAAGTCCAACTGATGGGCCCAGGAACCGGAATGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064327 Nonsense 247 445 3 4
Genomic Location:
Chromosome 10 (position 26456318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAGATTAAACTAAATATAAGTTGTCCTCTCTTTAGTAAAGCGCTAC[A/T]AAAGTCCAACTGATGGGCCCAGGAACCGGAATGAGATCCTGCAATGTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link