si:ch211-45m15.1

Ensembl ID:
ENSDARG00000043847
ZFIN ID:
ZDB-GENE-040724-54
Description:
hypothetical protein LOC556137 [Source:RefSeq peptide;Acc:NP_001038261]
Human Orthologue:
C6orf191
Human Description:
chromosome 6 open reading frame 191 [Source:HGNC Symbol;Acc:21571]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36940 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064375 Essential Splice Site 143 174 6 6
Genomic Location (Zv9):
Chromosome 20 (position 2137686)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2091971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCACTGAACTTGAAGTAATCATGGTAATACGCGTGTCTTCTGTCTCGT[A/G]GGCTCGGGGTTATTGATGATGATTTTTGGCGGGCAGCTTCTGGCTTATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link