rab3ab

Ensembl ID:
ENSDARG00000043835
ZFIN ID:
ZDB-GENE-041210-268
Description:
ras-related protein Rab-3A [Source:RefSeq peptide;Acc:NP_001017761]
Human Orthologue:
RAB3A
Human Description:
RAB3A, member RAS oncogene family [Source:HGNC Symbol;Acc:9777]
Mouse Orthologue:
Rab3a
Mouse Description:
RAB3A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97843]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10193 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104289 Nonsense 11 220 2 5
ENSDART00000124350 Nonsense 78 287 2 5
Genomic Location:
Chromosome 11 (position 6916737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCCCCTTAATCTTCCAGATGGCTTCAGCTACAGACAACCGTTATGGA[C/T]AAAAGRAGTCTTCTGACCAGAACTTTGATTACATGTTCAAAATCCTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/naggwmcc