klf7l

Ensembl ID:
ENSDARG00000043821
ZFIN ID:
ZDB-GENE-041014-171
Description:
Kruppel-like factor 7 (ubiquitous), like [Source:RefSeq peptide;Acc:NP_001038231]
Human Orthologue:
KLF7
Human Description:
Kruppel-like factor 7 (ubiquitous) [Source:HGNC Symbol;Acc:6350]
Mouse Orthologue:
Klf7
Mouse Description:
Kruppel-like factor 7 (ubiquitous) Gene [Source:MGI Symbol;Acc:MGI:1935151]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31721 Essential Splice Site Available for shipment Available now
sa8567 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31720 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064343   None 195 None 3
ENSDART00000104317 Essential Splice Site 237 295 2 4
ENSDART00000142295 Essential Splice Site 203 261 1 3
Genomic Location (Zv9):
Chromosome 9 (position 29396025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28551971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTACACAAAAAGCTCCCACCTGAAGGCACACCAGAGGACACATACAG[G/A]TGATTGACTGCAGACATTATATTGTTAATTTTTATTCACATGTTGTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064343   None 195 None 3
ENSDART00000104317 Essential Splice Site 238 295 3 4
ENSDART00000142295 Essential Splice Site 204 261 2 3
Genomic Location (Zv9):
Chromosome 9 (position 29389226)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28545172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGAATGGTGAAGSGGGGATTAAATGATGTGTGTTTGTGCATGC[A/T]GGTGAGAAGCCTTACAAATGCYCCTGGGAAGGCTGTGAATGGCGTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064343   None 195 None 3
ENSDART00000104317 Essential Splice Site 279 295 3 4
ENSDART00000142295 Essential Splice Site 245 261 2 3
Genomic Location (Zv9):
Chromosome 9 (position 29389099)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28545045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCAAACACACTGGTGCCAAACCTTTCAAGTGCAACCACTGCGACAGG[T/C]AAGAGAAGCACAGCAAAAGCTCCAAAACTAGCTTTCAATAAAAGTAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link