si:ch211-51n14.2

Ensembl ID:
ENSDARG00000043816
ZFIN ID:
ZDB-GENE-041014-161
Description:
hypothetical protein LOC799868 [Source:RefSeq peptide;Acc:NP_001076403]
Human Orthologue:
ST6GALNAC1
Human Description:
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran
Mouse Orthologues:
Gm11735, St6galnac1
Mouse Descriptions:
predicted gene 11735 Gene [Source:MGI Symbol;Acc:MGI:3713525]
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24910 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14861 Nonsense Available for shipment Available now
sa2629 Nonsense F2 line generated During 2017
sa2651 Nonsense F2 line generated During 2017
sa22086 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064335 Essential Splice Site 36 427 1 9
ENSDART00000112847 Essential Splice Site 36 270 1 10

The following transcripts of ENSDARG00000043816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 22044240)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20569821
KASP Assay ID:
554-7537.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTGTCACATTTTATAATGGAACTAGCACTTTACAGATAAAATGGAG[G/A]TAAGAAACTTTACCAAATCGAATCTGCATTAACGTGAAGTTACAGGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064335 Nonsense 108 427 2 9
ENSDART00000112847 Nonsense 108 270 2 10

The following transcripts of ENSDARG00000043816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 22044532)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20570113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAACACAAATTCACTTCCTTGCCTCACTGGAAATTTGATGATCTGTAT[C/T]GATTGGACCCACATTTTAAACMGAGTGTAAGTACAGTCTACAATAACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2629
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064335 Nonsense 247 427 5 9
ENSDART00000112847 Nonsense 247 270 5 10

The following transcripts of ENSDARG00000043816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 22049186)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20574767
KASP Assay ID:
554-2558.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATCATAGCAGGACATGAGGAGGATGTTGGGAAAAGGACATCGGTTTA[T/A]GTTCACACAGCACATTCCATAATCCAGTCCCTCATGATACACAAAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2651
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064335 Nonsense 307 427 6 9
ENSDART00000112847   None 270 7 10

The following transcripts of ENSDARG00000043816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 22049434)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20575015
KASP Assay ID:
554-3169.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGTCTCTYATGAAGAACAGAAAAATACCATCAGGAGCATATCGAGGA[C/T]GAACGTAAGTTAATTTAACAGAAANNNNNAATAAGTARTAAGGCTTGACATTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064335 Essential Splice Site 336 427 None 9
ENSDART00000112847 Essential Splice Site None 270 None 10

The following transcripts of ENSDARG00000043816 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 22050933)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20576514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTACTACATCCTCCATCCAGATTTTCTCAGATATGTGCGAAACAGG[T/C]ACATCCTGAAAATGCATAATTTATTCCTCTTTATGTTTCTGTAAATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link