si:ch211-51n14.1

Ensembl ID:
ENSDARG00000043814
ZFIN ID:
ZDB-GENE-041014-160
Description:
Novel protein similar to vertebrate sialyltransferase 7 family [Source:UniProtKB/TrEMBL;Acc:Q5P990]
Human Orthologue:
ST6GALNAC1
Human Description:
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran
Mouse Orthologues:
Gm11735, St6galnac1
Mouse Descriptions:
predicted gene 11735 Gene [Source:MGI Symbol;Acc:MGI:3713525]
ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltran

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14762 Essential Splice Site Available for shipment Available now
sa4464 Essential Splice Site F2 line generated During 2017
sa35279 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 97 407 None 9
ENSDART00000146762 Essential Splice Site 49 358 None 8
Genomic Location (Zv9):
Chromosome 12 (position 22032179)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20557760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGACTTTGAAGATGTCTATTTGCGAGACMGTAATGCAAGAAAACCGG[T/G]AAGTGCTTCTTTTCTAASACCARTTTTACATCACATTGCAGTTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4464
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 152 407 3 9
ENSDART00000146762 Essential Splice Site 104 358 2 8
Genomic Location (Zv9):
Chromosome 12 (position 22032444)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20558025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCACACTTTAACAATCCCTTTGGCTTCATGGAGTACAATTACAATGG[T/G]AAACACWGCTCATTACTGGCAGGATTTCWTAGTGCCTTTAGATGTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064334 Essential Splice Site 316 407 7 9
ENSDART00000146762 Essential Splice Site 268 358 6 8
Genomic Location (Zv9):
Chromosome 12 (position 22037690)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20563271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATTTAACGTTCTACACCCCGATTTCCTTCGTTACATTCGCAACAGG[T/C]AACAAAAGTGAACAGTTTGTCAGGTCATTGAACAACCTGAGATCTGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link