si:dkey-109i21.1

Ensembl ID:
ENSDARG00000043806
ZFIN ID:
ZDB-GENE-091113-23
Human Orthologue:
POSTN
Human Description:
periostin, osteoblast specific factor [Source:HGNC Symbol;Acc:16953]
Mouse Orthologue:
Postn
Mouse Description:
periostin, osteoblast specific factor Gene [Source:MGI Symbol;Acc:MGI:1926321]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34911 Nonsense Mutation detected in F1 DNA During 2017
sa34910 Nonsense Mutation detected in F1 DNA During 2017
sa34909 Nonsense Mutation detected in F1 DNA During 2017
sa41666 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017240 Nonsense 116 1016 4 26
ENSDART00000134176   None 153 None 7
ENSDART00000147677 Nonsense 116 695 6 20
Genomic Location (Zv9):
Chromosome 10 (position 26430120)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25833977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTTTATGGCACCTTGGATCTGGTAAAAGCCAAAACCACTCAGCAATA[T/G]GCGGATCAATCCAAACTGAGGGAAGAAATTGCGGGAGAAGGATCTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017240 Nonsense 162 1016 5 26
ENSDART00000134176   None 153 None 7
ENSDART00000147677 Nonsense 162 695 7 20
Genomic Location (Zv9):
Chromosome 10 (position 26429785)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25833642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGCATCGAAGGCTGCTGTGATCAGCCTTGGAAACACTGAGCTTTA[C/A]AATGCACTTCACTATCACATGGTCAGCAAACGGTTTCTCACCAAGGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017240 Nonsense 586 1016 13 26
ENSDART00000134176   None 153 None 7
ENSDART00000147677 Nonsense 586 695 15 20
Genomic Location (Zv9):
Chromosome 10 (position 26415801)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25819658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCATCTTTATTAACGGAGGTCTGGAGGGTGGAGTGACTAACCTCCTC[A/T]AGACCATACAGGGAAACAACCTTCAAGTGCTGTCTGTAAGTAGACAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017240 Nonsense 662 1016 16 26
ENSDART00000134176   None 153 None 7
ENSDART00000147677 Nonsense 662 695 18 20
Genomic Location (Zv9):
Chromosome 10 (position 26409417)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25813274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTTTGTATGTGTGTGTGTGTAGTTTGTATCTGGATACACCTAT[C/T]GAGACATTCCACTTACATTTATCAGTAAGTTTAGTTTTATTCTTCTTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link