ms4a17a.9

Ensembl ID:
ENSDARG00000043802
ZFIN ID:
ZDB-GENE-050320-79
Description:
membrane-spanning 4-domains, subfamily A, member 17A.9 [Source:RefSeq peptide;Acc:NP_001013528]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8854 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064318 Essential Splice Site 110 241 4 7
ENSDART00000133799 Essential Splice Site 116 247 4 7
ENSDART00000141114 Essential Splice Site 116 247 4 7
Genomic Location:
Chromosome 4 (position 60668120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTCCATTGCTGCTGAAAACAAAATTAATTCACCATCTGCTTTATGTTTGG[T/C]ATGTACACAACACTTGTTCTTTTYATNNNTTAARCAMTGGGYRCTTGTAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2p31h272