LOC100334314

Ensembl ID:
ENSDARG00000043799
Human Orthologue:
KLHL29
Human Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Mouse Orthologue:
Klhl29
Mouse Description:
kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36291 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36292 Nonsense Mutation detected in F1 DNA During 2016
sa42853 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16249 Nonsense Available for shipment Available now
sa36293 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 139 855 2 12
Genomic Location:
Chromosome 17 (position 4398683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACAGACGAACCGCCCGCAAAGCAGATGAGGGAGAAAGATATCGCAG[G/A]TAAAAGAAAATCTCTTATTTGCTCTCTTCTTTCTTGCTCGGATTGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Nonsense 298 855 4 12
Genomic Location:
Chromosome 17 (position 4440549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCGTGCAAATCACTGTTTCTCTTCTTTCTCTCGTTCCTACAGAAATGT[T/A]GAAGGAATTGAACCAGCAGCGGAGAGAGAAAGAGTTTACAGACCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 342 855 4 12
Genomic Location:
Chromosome 17 (position 4440683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTCTAGCTTCCTGCAGCTTGTATTTCAAGGACATGGTGAAAAGG[T/C]TTGCTTGATCTGTCGTCGTCTTCTTTTTCGTAGGGTGCATTTGTGTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Nonsense 595 855 8 12
Genomic Location:
Chromosome 17 (position 4534864)
KASP Assay ID:
2261-0515.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCGCTCTCTGACAGCCGTCACCTGCTTCAACCCTCAGAAMAACAARTG[G/A]TACCCGCTGGCCAGCCTMCCCTTCTACAACCGYGAGTTCTTCTCGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038730 Essential Splice Site 682 855 9 12
Genomic Location:
Chromosome 17 (position 4537135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCCATTGGAGGACTCGGAGCGGCTGGAAATCTGGACAATGTGGAGAG[G/A]TAACATTCAGTCCTGCTGCGCTGTGTGTGAGTGGAGGTGTGTGTTTAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link