cdc5l

Ensembl ID:
ENSDARG00000043797
ZFIN ID:
ZDB-GENE-040426-821
Description:
CDC5 cell division cycle 5-like [Source:RefSeq peptide;Acc:NP_957378]
Human Orthologue:
CDC5L
Human Description:
CDC5 cell division cycle 5-like (S. pombe) [Source:HGNC Symbol;Acc:1743]
Mouse Orthologues:
Cdc5l, Gm9049
Mouse Descriptions:
cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]
predicted gene 9049 Pseudogene [Source:MGI Symbol;Acc:MGI:3644216]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22983 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22984 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa16815 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064313 Essential Splice Site 301 468 7 10
ENSDART00000121806 Essential Splice Site 301 801 7 16
Genomic Location:
Chromosome 17 (position 4847647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGAGTTCACCAAGAAGAGGAGCAAACTAGTGCTGCCGGCACCACAG[G/A]TCAGAGACAAGCTCAGATAATTAACACATTAAACACTAAACAGCTACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064313 None None 468 None 10
ENSDART00000121806 Splice Site, Nonsense 523 801 11 16
Genomic Location:
Chromosome 17 (position 4858758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGACGAGAGCTTTGTGGAGGACGCGGCTGAGATCGAACTGCGTAAA[C/T]AGGCCAGTTAACCTCTGCAAACACACTGATGTTCATGAAGTGATCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064313 None None 468 None 10
ENSDART00000121806 Nonsense 708 801 15 16
Genomic Location:
Chromosome 17 (position 4869040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTATTTYTCCATCAGATGAACCGTGGCCAYATGACGGCGGAGGCGAAG[C/T]GAGCAGCRAAGATGGAGAAGAAGATGAAGATCCTGCTGGGTGGATATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8al6bmzf