si:ch211-282j17.3

Ensembl ID:
ENSDARG00000043767
ZFIN ID:
ZDB-GENE-041210-287
Description:
hypothetical protein LOC568449 [Source:RefSeq peptide;Acc:NP_001025393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40825 Nonsense Mutation detected in F1 DNA During 2017
sa26868 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064277 Nonsense 100 370 2 4
ENSDART00000142591 Nonsense 100 370 3 5
ENSDART00000145038 Nonsense 100 254 3 4
Genomic Location (Zv9):
Chromosome 7 (position 3830269)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3520683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATAAATGGCATTGGTCTTCAGGTGATCCTGCGCTCCTTCTGAACTG[G/A]GCATCTGGACAACCAGCCGGCAGTGATGATTGCGCTGTTATGAGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064277 Nonsense 243 370 3 4
ENSDART00000142591 Nonsense 243 370 4 5
ENSDART00000145038   None 254 None 4
Genomic Location (Zv9):
Chromosome 7 (position 3828964)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3519378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAATCAGAATGCACAGGGACGATGGCATGACATCTCGTGCACCGGCT[C/A]ATTTCCTTTTGTGTGTCATGAAGGTGAGCAGATCCTCCAAACACACTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link