nrxn3a

Ensembl ID:
ENSDARG00000043746
ZFIN IDs:
ZDB-GENE-070206-9, ZDB-GENE-070206-9, ZDB-GENE-070206-9
Description:
neurexin 3a [Source:RefSeq peptide;Acc:NP_001073478]
Human Orthologue:
NRXN3
Human Description:
neurexin 3 [Source:HGNC Symbol;Acc:8010]
Mouse Orthologue:
Nrxn3
Mouse Description:
neurexin III Gene [Source:MGI Symbol;Acc:MGI:1096389]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2921 Nonsense F2 line generated During 2017
sa18056 Nonsense Available for shipment Available now
sa14031 Nonsense Available for shipment Available now
sa11330 Nonsense Available for shipment Available now
sa36373 Nonsense Mutation detected in F1 DNA During 2017
sa32142 Essential Splice Site Available for shipment Available now
sa9245 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36372 Essential Splice Site Available for shipment Available now
sa36371 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23034 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2921
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Nonsense 39 1697 1 33
ENSDART00000109034 Nonsense 39 261 2 2
Genomic Location (Zv9):
Chromosome 17 (position 17271478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17421489
KASP Assay ID:
554-3195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTGGAGTTTACAGGGTTGCAAGGCCAGTGGGCACGCTATCTCCGCTG[G/A]GACGCCAGCACCAGAAGTGACCTCAGCTTCCAGTTCAAAACAGACGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Nonsense 150 1697 1 33
ENSDART00000109034 Nonsense 150 261 2 2
Genomic Location (Zv9):
Chromosome 17 (position 17271147)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17421158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGCAGTACATGAAGATCGTTAGTGACCTCTTCCTGGGCGGAGTCCCT[C/T]AAGATATTCGCATTTCTGTGCTCACTCTCCCGACAGTGAAGGATCTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179   None 1697 None 33
ENSDART00000109034 Nonsense 238 261 2 2
Genomic Location (Zv9):
Chromosome 17 (position 17270881)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17420892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACGGAATATGTTGGCCGATTCTGCAACGAAGGTAAATATATGGTTTA[T/A]ATATCAAAGCAGATACAGTGTAAAATCTTTAAATTTATTGGCAAAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Nonsense 455 1697 8 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 17148445)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17298456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATTGTGGACCCCAAGATGAAGATMCAGGGCGATGTGGTGTTCAAGTG[T/A]GAAAACGTGGCAACGCTGGATCCRATTTCGTTCGAGACGCCTGAGGCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Nonsense 674 1697 9 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 17143384)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17293395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGGCAAACAGTGCGACAGTTACCCATGCAAAAACAAAGGCTTGTGC[A/T]AAGAAGGCTGGAATCGGTTTATCTGTGACTGCACAGGCACTGGTTACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Essential Splice Site 696 1697 9 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 17143314)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17293325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTGACTGCACAGGCACTGGTTACTGGTCCCGCACCTGCGAGAGGG[G/A]TGAGTTCACTGATTTTACACTTACAAGCCTGGATTTATGGAGTTTGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241   None 672 None 17
ENSDART00000088179 Essential Splice Site 814 1697 12 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 17103438)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17253449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGGGGCAAAAGCTACAAGCTAACGGTTGAYGATGAMGTAGCAGAAGG[T/C]ACTATCCTTGGTCCTCAATCTGAAAGACAAGCACAATTCTTGATGGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241 Essential Splice Site 87 672 1 17
ENSDART00000088179   None 1697 None 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 16960231)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 17110242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCCATTTCCATATACCGCTCTCCAGCGTTTCTTAGAAGCGGACATGG[T/C]GAGTTTGCATGGAGTTGTACCATTTGAGAAGACTTGCTTGCTGTTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241 Essential Splice Site 336 672 15 17
ENSDART00000088179 Essential Splice Site 1361 1697 31 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 16804161)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16954989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTCTACCACCACCACCAGAAAACACCGCACCCCACCAACAATACAGG[T/C]AATGCACAACACACATGAAAAACACATGAGAGAAATGTGTGCTGAGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064241 Nonsense 352 672 16 17
ENSDART00000088179 Nonsense 1377 1697 32 33
ENSDART00000109034   None 261 None 2
Genomic Location (Zv9):
Chromosome 17 (position 16768421)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 16919249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGACCACGGATGACATGGTTTCGTCGGCCGAGTGTTCCAGTGACGAC[G/T]AGGACTTTGCGGAGTGCGAAGGACATGCAGGTGGGCTAGGTCAGTTCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link