trmu

Ensembl ID:
ENSDARG00000043734
ZFIN ID:
ZDB-GENE-050522-540
Description:
Mitochondrial tRNA-specific 2-thiouridylase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q503J2]
Human Orthologue:
TRMU
Human Description:
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase [Source:HGNC Symbol;Acc:25481]
Mouse Orthologue:
Trmu
Mouse Description:
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase Gene [Source:MGI Symbol;Acc:MGI:1919276]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18152 Nonsense Available for shipment Available now
sa11645 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064219 Nonsense 177 416 5 11
Genomic Location:
Chromosome 4 (position 27659808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCGGCTTTATCAAGGTGCTGATCTGTTGAAGGACCAGACGTTCTTCT[T/G]AAGTCAGATCTCCCAGGATGCTTTGYGAMACACATTATTTCCCCTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064219 Nonsense 186 416 5 11
Genomic Location:
Chromosome 4 (position 27659782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGAAGGACCAGACGTTCTTCTTAAGTCAGATCTCCCAGGATGCTTTG[C/T]GAMACACATTATTTCCCCTGGCTGGACTAACCAAAGGGTATGTGAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nsh7npkb