cops4

Ensembl ID:
ENSDARG00000043732
ZFIN ID:
ZDB-GENE-030131-4317
Description:
COP9 signalosome complex subunit 4 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0H6]
Human Orthologue:
COPS4
Human Description:
COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) [Source:HGNC Symbol;Acc:16702]
Mouse Orthologue:
Cops4
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 4 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa215 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064215 Nonsense 184 406 5 10
Genomic Location:
Chromosome 10 (position 11326169)
KASP Assay ID:
554-0119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCAACCGAGCGTCKTTATTGCAGAATGAATCCACCAATGAACAGTTG[C/T]AGATTCACTACAAGGTGATCTTTCAGCTCTRTCTTTTTATAATATGCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cimyv55w