cdc45

Ensembl ID:
ENSDARG00000043720
ZFIN ID:
ZDB-GENE-040426-2710
Description:
CDC45-related protein [Source:RefSeq peptide;Acc:NP_998551]
Human Orthologue:
CDC45
Human Description:
cell division cycle 45 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1739]
Mouse Orthologue:
Cdc45
Mouse Description:
cell division cycle 45 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1338073]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064201 Essential Splice Site 203 572 None 18

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 4962060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAGATTCTMTTTGACTATGAGCAGTACGAGTTTCATGGAACATCAG[T/A]GAGTAATAATTGATCTTTTATAAATATTTCTGATCTTATGCAGAACATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mswfoeim