si:dkey-114g7.4

Ensembl ID:
ENSDARG00000043718
ZFIN ID:
ZDB-GENE-060503-897
Description:
F-box only protein 46 [Source:RefSeq peptide;Acc:NP_001076300]
Human Orthologue:
FBXO46
Human Description:
F-box protein 46 [Source:HGNC Symbol;Acc:25069]
Mouse Orthologue:
Fbxo46
Mouse Description:
F-box protein 46 Gene [Source:MGI Symbol;Acc:MGI:2444918]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35820 Nonsense Mutation detected in F1 DNA During 2017
sa9057 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064199 Nonsense 563 664 1 1
ENSDART00000131212 Nonsense 563 664 2 2
Genomic Location (Zv9):
Chromosome 15 (position 13598570)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14663141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGCTATCTGCCCACCCATTCTTTAGCAGCCCTCAAATGCACCTG[C/A]CATGACTTCAAGACCCTGATTGAGACCTACGGTGTGCGTGCTACAGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064199 Nonsense 640 664 1 1
ENSDART00000131212 Nonsense 640 664 2 2
Genomic Location (Zv9):
Chromosome 15 (position 13598341)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14663370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTACTGGATGTGTTGTCGGCGCACAGATAAGGACACTCCTGGCTGT[C/T]GAGTTGGGCTACATGATAACAACTGGGTACAGCCATGTGAGCTGGTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link