parvaa

Ensembl ID:
ENSDARG00000043710
ZFIN ID:
ZDB-GENE-040721-2
Description:
parvin, alpha a [Source:RefSeq peptide;Acc:NP_001002872]
Human Orthologue:
PARVA
Human Description:
parvin, alpha [Source:HGNC Symbol;Acc:14652]
Mouse Orthologue:
Parva
Mouse Description:
parvin, alpha Gene [Source:MGI Symbol;Acc:MGI:1931144]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064187 Nonsense 265 372 9 13
ENSDART00000104069 Nonsense 265 372 9 13
Genomic Location (Zv9):
Chromosome 25 (position 16695243)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16241787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTTTTGATACATTGTTTGATCATGCTCCYGACAAGCTGAGTGTGGTG[A/T]AGAAGGTATGAAAGAGCACAAATATTAGCTGAATTGACATCCTAAGGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link