mobkl2c

Ensembl ID:
ENSDARG00000043705
ZFIN ID:
ZDB-GENE-040704-32
Description:
mps one binder kinase activator-like 2C [Source:RefSeq peptide;Acc:NP_001002191]
Human Orthologue:
MOBKL2C
Human Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) [Source:HGNC Symbol;Acc:29800]
Mouse Orthologue:
Mobkl2c
Mouse Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2140623]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18422 Nonsense Available for shipment Available now
sa35045 Nonsense Available for shipment Available now
sa44736 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 20 216 2 4
Genomic Location (Zv9):
Chromosome 11 (position 13352350)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13109173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCTTGGGTCAGGTGTTCAGCAAAGACAAGACGTTTCGGCCTCGAAAR[C/T]GATTCGAACCTGGGACCCAACGTTTCGAGCTATACAAAAGAGYCCAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 75 216 2 4
Genomic Location (Zv9):
Chromosome 11 (position 13352517)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13109340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATCGCTGTACATGTTGTGGATTTCTTCAATCGGATCAACCTAATCTA[C/A]GGGACAGTGAGCGAGTTCTGCACTGAGAAGAGCTGTCCCATCATGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 187 216 3 4
Genomic Location (Zv9):
Chromosome 11 (position 13356888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACATGATCTGCAGTATAGGAGCTGAGGCTCACATCAACACCTGTTAC[A/T]AACACTACTACTACTTCATCTCGGAGTTCAGCCTCATTGACCACTCTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link