mobkl2c

Ensembl ID:
ENSDARG00000043705
ZFIN ID:
ZDB-GENE-040704-32
Description:
mps one binder kinase activator-like 2C [Source:RefSeq peptide;Acc:NP_001002191]
Human Orthologue:
MOBKL2C
Human Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) [Source:HGNC Symbol;Acc:29800]
Mouse Orthologue:
Mobkl2c
Mouse Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2140623]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 20 216 2 4
Genomic Location:
Chromosome 11 (position 13352350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCTTGGGTCAGGTGTTCAGCAAAGACAAGACGTTTCGGCCTCGAAAR[C/T]GATTCGAACCTGGGACCCAACGTTTCGAGCTATACAAAAGAGYCCAGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqyywtuv