bpnt1

Ensembl ID:
ENSDARG00000043684
ZFIN ID:
ZDB-GENE-040718-46
Description:
3'(2'),5'-bisphosphate nucleotidase 1 [Source:RefSeq peptide;Acc:NP_001002354]
Human Orthologue:
BPNT1
Human Description:
3'(2'), 5'-bisphosphate nucleotidase 1 [Source:HGNC Symbol;Acc:1096]
Mouse Orthologue:
Bpnt1
Mouse Description:
bisphosphate 3'-nucleotidase 1 Gene [Source:MGI Symbol;Acc:MGI:1338800]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19227 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10404 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6

The following transcripts of ENSDARG00000043684 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 9318257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACAGCCATTGCTGGAGTCATCAATCAACCTTTCTACAACTACCAGG[T/A]CCAACAGATTGATTGGTCATACATTTTACTGCTCTGTATTTTATGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6

The following transcripts of ENSDARG00000043684 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 9318257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACAGCCATTGCTGGAGTMATCAATCAACCTTTCTACAACTACCAGG[T/A]CCAACWGATTGATTGGTCATAYATTTTACTGCTCTGTATTTTATGGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bwrzkf53