ENSDARG00000043682

Ensembl ID:
ENSDARG00000043682

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17135 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064142 Splice Site None 596 None 14
ENSDART00000102399 Nonsense 254 590 7 15
Genomic Location:
Chromosome 1 (position 637709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAATCAGGGTTTCTTTAAATGCAGRAAKGCTCATCTGAATTTAAAT[A/T]AGTGTATATGCAGGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42vpvvmv