olfcg3

Ensembl ID:
ENSDARG00000043681
ZFIN ID:
ZDB-GENE-060503-159
Description:
similar to putative pheromone receptor CPpr3 [Source:RefSeq peptide;Acc:NP_001103412]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15887 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064141 Nonsense 340 837 3 6
Genomic Location:
Chromosome 14 (position 17862746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAAATCAGTGTTGAAGGCTTTGCTGAATATGCCATTAACGAATTTTG[G/A]AAAAAAGRTTTTCCATGTTTAAAGAGTGAGGTTAATTCATCTCGATATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qqi3iahx