si:ch211-59d15.5

Ensembl ID:
ENSDARG00000043680
ZFIN ID:
ZDB-GENE-030131-2196
Description:
Novel protein similar to vertebrate YLP motif containing 1 (YLPM1) [Source:UniProtKB/TrEMBL;Acc:Q5RG
Human Orthologue:
YLPM1
Human Description:
YLP motif containing 1 [Source:HGNC Symbol;Acc:17798]
Mouse Orthologue:
Ylpm1
Mouse Description:
YLP motif containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926195]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10998 Nonsense Available for shipment Available now
sa3057 Nonsense F2 line generated During 2017
sa23640 Nonsense Available for shipment Available now
sa43386 Nonsense Mutation detected in F1 DNA During 2017
sa14245 Nonsense Available for shipment Available now
sa11546 Essential Splice Site Available for shipment Available now
sa17220 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 226 1424 3 18
ENSDART00000133012 Nonsense 226 1424 4 20
Genomic Location (Zv9):
Chromosome 20 (position 9370461)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9204730
KASP Assay ID:
2261-3996.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGACAGAATACCCCTACACGCTTTGAAAGACCTCCTGTAGCYTCTCAA[C/T]AAACTRGTTCTGGTCAACAATCCARTCCTGTAACTGGCAATCAAACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3057
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 445 1424 3 18
ENSDART00000133012 Nonsense 445 1424 4 20
Genomic Location (Zv9):
Chromosome 20 (position 9369804)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9204073
KASP Assay ID:
554-2645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATTCCTATGACCATCAGGAACCAGGCAACGCAAGTCATRGCGAGGAT[C/T]AGGATCGTATTTGGAGAGATCCTTCTTTAGATGGTCCTGAAGAAATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 565 1424 3 18
ENSDART00000133012 Nonsense 565 1424 4 20
Genomic Location (Zv9):
Chromosome 20 (position 9369444)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9203713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCCACTTGGACCTCCTCCGTTTCGACCACGTGGGGGAGTTGTACCA[C/T]GATTCAGACGTGGTTTAGGCCCTTGGGGACCATTACCCCGCCATGACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 664 1424 3 18
ENSDART00000133012 Nonsense 664 1424 4 20
Genomic Location (Zv9):
Chromosome 20 (position 9369147)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9203416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAAGAGAAAGGTGGCATGGCCCACCACCTCATGAAGAAGAGAATTAT[G/T]AGGAGGAATACCCATATGGTGCAGAGGATGATGTGTACAGAAGGCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 753 1424 3 18
ENSDART00000133012 Nonsense 753 1424 4 20
Genomic Location (Zv9):
Chromosome 20 (position 9368878)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9203147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATATAGAGAAGAACGAAGGGGACCTTTTTACCCTGATGATCCACCTTA[T/G]CAAGACCGAGATCGGGAGCCTCCATTTCATTCACGTTCTGATTGGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Essential Splice Site 1292 1424 14 18
ENSDART00000133012 Essential Splice Site 1292 1424 15 20
Genomic Location (Zv9):
Chromosome 20 (position 9361105)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9195374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGYGMGACTAGATATCAGGTCTCTTCTGCAGGATGCAGCAATCGAGGATG[T/A]GAGTGTTTTSATGACTTATGCTGTTATGTTAATTNNNAAAGTCAATTTAAATH
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064140 Nonsense 1392 1424 18 18
ENSDART00000133012 Nonsense 1392 1424 19 20
Genomic Location (Zv9):
Chromosome 20 (position 9351634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9185903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGTGCGCTGGGCTGATCTTGAAGAGCAGAAGGATGTCGACCGAAAG[C/T]GAGCGATTGGTTTTGTTGTCGGTCAGACAGACTGGGAAAAAATCACGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link