si:dkey-174m14.3

Ensembl ID:
ENSDARG00000043673
ZFIN ID:
ZDB-GENE-030131-8158
Description:
brain-enriched guanylate kinase-associated protein [Source:RefSeq peptide;Acc:NP_001038475]
Human Orthologue:
BEGAIN
Human Description:
brain-enriched guanylate kinase-associated homolog (rat) [Source:HGNC Symbol;Acc:24163]
Mouse Orthologue:
Begain
Mouse Description:
brain-enriched guanylate kinase-associated Gene [Source:MGI Symbol;Acc:MGI:3044626]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43389 Nonsense Mutation detected in F1 DNA During 2017
sa368 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064130 Nonsense 36 632 2 6
ENSDART00000142337 Nonsense 8 604 2 6

The following transcripts of ENSDARG00000043673 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 9574529)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9408798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTGGTCATATGAAGTGAATGTAATGGTCTGTCTGCAGCTCTCTG[C/T]AGGAGCAGAAGGAGGACCTGCGCAAGCGTCTCTCTTACACCACTCATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064130 Nonsense 304 632 6 6
ENSDART00000142337 Nonsense 276 604 6 6

The following transcripts of ENSDARG00000043673 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 9597103)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9431372
KASP Assay ID:
554-0238.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCCAGAACTCCACGGATAGCAACCCAGAAGAGGGATCAATGTCCCTA[C/T]AGCCTGGCTTCTCGCAGGACCACTTCCGAAAGTTTACAACCTCTCTGGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link