CADPS (1 of 2)

Ensembl ID:
ENSDARG00000043661
Description:
Ca++-dependent secretion activator [Source:HGNC Symbol;Acc:1426]
Human Orthologue:
CADPS
Human Description:
Ca++-dependent secretion activator [Source:HGNC Symbol;Acc:1426]
Mouse Orthologue:
Cadps
Mouse Description:
Ca2+-dependent secretion activator Gene [Source:MGI Symbol;Acc:MGI:1350922]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21886 Nonsense Mutation detected in F1 DNA During 2014
sa15647 Essential Splice Site Available for shipment Available now
sa14101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029680 Nonsense 397 1316 6 30
Genomic Location:
Chromosome 11 (position 20304100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCGAATTGTTTACTGCACCATGGAGGTGGAAGGAGGACAGAAACTT[C/T]AGACAGATCAAGCAGAGGCCTCTAAACCAACGTAAGTCTCTTGCCAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029680 Essential Splice Site 784 1316 16 30
Genomic Location:
Chromosome 11 (position 20385170)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCAGCTACTCTCAAAAGTGAGCATGCAGTTGATTTGTGRTGTTTTTC[A/T]GGTCCTGATGAARGACATTGTGACCCCGGTTCCTCAGGATGAGGTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029680 Nonsense 1034 1316 23 30
Genomic Location:
Chromosome 11 (position 20419477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACYGTGTTCTGTGGTGWTTTCAGCAATGGTTCGGGGACGTCTGAAGAYT[T/A]GTTTTGGAAGCKGGACGCTCTGCAAACATTCATTAGAGACCTGCACTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5yryx7h3