cxadr

Ensembl ID:
ENSDARG00000043658
ZFIN ID:
ZDB-GENE-020814-2
Description:
Coxsackievirus and adenovirus receptor homolog [Source:UniProtKB/Swiss-Prot;Acc:Q90Y50]
Human Orthologues:
C1orf204, CXADR
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
coxsackie virus and adenovirus receptor [Source:HGNC Symbol;Acc:2559]
Mouse Orthologue:
Cxadr
Mouse Description:
coxsackie virus and adenovirus receptor Gene [Source:MGI Symbol;Acc:MGI:1201679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31783 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064107 Essential Splice Site 74 372 2 7
Genomic Location (Zv9):
Chromosome 10 (position 27768974)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27171768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAGTGGAGCTTGCAGCCCTCCGACAACCAGAAAGAAGAGAAAGTGG[T/C]GAGTAGACAATGTGATTGTATTTTGTGTTATGTGTCTGCGTGACTCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link