pnck

Ensembl ID:
ENSDARG00000043648
ZFIN ID:
ZDB-GENE-081105-127
Description:
Novel protein similar to vertebrate pregnancy upregulated non-ubiquitously expressed CaM kinase (PNC
Human Orthologue:
PNCK
Human Description:
pregnancy up-regulated non-ubiquitously expressed CaM kinase [Source:HGNC Symbol;Acc:13415]
Mouse Orthologue:
Pnck
Mouse Description:
pregnancy upregulated non-ubiquitously expressed CaM kinase Gene [Source:MGI Symbol;Acc:MGI:1347357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45311 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38671 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064090 Essential Splice Site 69 316 2 10
Genomic Location (Zv9):
Chromosome 8 (position 9697532)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9114114
GRCz11 8 9152699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGGGAAAAGAATCCATGCTGGAGAATGAGGTTGCGGTATTACGCAG[G/A]TCAGTTATTTGGCAAACAGCGTTCTTGACTGATTGGTTAAATTTCTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064090 Essential Splice Site 140 316 4 10
Genomic Location (Zv9):
Chromosome 8 (position 9699574)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9116156
GRCz11 8 9154741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCGTGAAGTATCTGCATCAGCTGGGCGTCGTGCATCGCGATCTAAAG[G/A]TAGCCGAGAACAAAACATAACACTTCCGTCTCGAGATTTTTAGTTTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link