EHBP1

Ensembl ID:
ENSDARG00000043643
Description:
EH domain binding protein 1 [Source:HGNC Symbol;Acc:29144]
Human Orthologue:
EHBP1
Human Description:
EH domain binding protein 1 [Source:HGNC Symbol;Acc:29144]
Mouse Orthologue:
Ehbp1
Mouse Description:
EH domain binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2667252]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2907 Splice Site, Nonsense Available for shipment Available now
sa11211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Splice Site, Nonsense 105 1243 5 27
Genomic Location:
Chromosome 17 (position 23999752)
KASP Assay ID:
554-2812.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTACATTTTAACTTGCCATCTCTTCTTTTTTTGTGTGTTATTTTAG[G/T]AGTCCCCATCGGGTCGTCGGAAAGCGCTGGCCACTAGCTGCATTAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Nonsense 1080 1243 20 27
Genomic Location:
Chromosome 17 (position 24105284)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACTCCCCCTTTCCTCTCGTTTGTTCTCTCCCAGCAGAAAGCGTTC[A/T]AAGACACCAGTCAGTACGTGGTGGGAGAACTGGCGGCGCTGGAGAGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p683f2k6