EHBP1

Ensembl ID:
ENSDARG00000043643
Description:
EH domain binding protein 1 [Source:HGNC Symbol;Acc:29144]
Human Orthologue:
EHBP1
Human Description:
EH domain binding protein 1 [Source:HGNC Symbol;Acc:29144]
Mouse Orthologue:
Ehbp1
Mouse Description:
EH domain binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2667252]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2907 Splice Site, Nonsense Available for shipment Available now
sa42932 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42933 Nonsense Mutation detected in F1 DNA During 2016
sa42934 Nonsense Mutation detected in F1 DNA During 2016
sa42935 Nonsense Mutation detected in F1 DNA During 2016
sa11211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Splice Site, Nonsense 105 1243 5 27
Genomic Location (Zv9):
Chromosome 17 (position 23999752)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24153194
KASP Assay ID:
554-2812.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTACATTTTAACTTGCCATCTCTTCTTTTTTTGTGTGTTATTTTAG[G/T]AGTCCCCATCGGGTCGTCGGAAAGCGCTGGCCACTAGCTGCATTAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Essential Splice Site 165 1243 5 27
Genomic Location (Zv9):
Chromosome 17 (position 23999935)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24153377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCCAGTTCTCCCTGTCCTGCATCTTCCTGCGAGAGGGCAAAGCCACG[T/A]AAGAGAAGCCCACCATACACACCTGCTAAACCAGCTGACTACACCCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Nonsense 358 1243 9 27
Genomic Location (Zv9):
Chromosome 17 (position 24014215)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24167657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAATCCTTTCTATGAGCCCAGATTGTCTGGCTCAGACAGTAGCACCT[T/A]AGAGAAGAGCATGAAGCGCCGGGCCCCACAGCCTCCCAGTGCTGGACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Nonsense 528 1243 12 27
Genomic Location (Zv9):
Chromosome 17 (position 24050391)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24203833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACATGGTTCTACTGGCGATCCCGGATAAGCTGACAGTGATGACTTA[C/A]CTGTATCAGATCAGGGCTCATTTCAGTGGCGAGGAGCTCAACGTGGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Nonsense 530 1243 12 27
Genomic Location (Zv9):
Chromosome 17 (position 24050397)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24203839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTCTACTGGCGATCCCGGATAAGCTGACAGTGATGACTTACCTGTA[T/A]CAGATCAGGGCTCATTTCAGTGGCGAGGAGCTCAACGTGGTGCAGATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064067 Nonsense 1080 1243 20 27
Genomic Location (Zv9):
Chromosome 17 (position 24105284)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24258726
KASP Assay ID:
2261-1048.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACTCCCCCTTTCCTCTCGTTTGTTCTCTCCCAGCAGAAAGCGTTC[A/T]AAGACACCAGTCAGTACGTGGTGGGAGAACTGGCGGCGCTGGAGAGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link