cenpn

Ensembl ID:
ENSDARG00000043640
ZFIN ID:
ZDB-GENE-030616-408
Description:
centromere protein N [Source:RefSeq peptide;Acc:NP_001002341]
Human Orthologue:
CENPN
Human Description:
centromere protein N [Source:HGNC Symbol;Acc:30873]
Mouse Orthologue:
Cenpn
Mouse Description:
centromere protein N Gene [Source:MGI Symbol;Acc:MGI:1919405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064080 Nonsense 173 345 5 10
Genomic Location:
Chromosome 18 (position 29850879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCCTACGTGTTTATTTCAAACCTCATGGCCAAACACAAAATCTTCT[T/A]ATGTCAGGTGATCTTTTTTTCATCTTTAGAAGACTTATTTGGAATTAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c9bgq7mn