NP_001036799.1

Ensembl ID:
ENSDARG00000043609
Description:
erythropoietin receptor [Source:RefSeq peptide;Acc:NP_001036799]
Human Orthologue:
EPOR
Human Description:
erythropoietin receptor [Source:HGNC Symbol;Acc:3416]
Mouse Orthologue:
Epor
Mouse Description:
erythropoietin receptor Gene [Source:MGI Symbol;Acc:MGI:95408]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19961 Nonsense Available for shipment Available now
sa179 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064033 Nonsense 207 509 5 8
Genomic Location (Zv9):
Chromosome 3 (position 14153028)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14405530
KASP Assay ID:
2259-3150.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATGCTGGTTTTGCGTGGTTTACAGCCCGACACCAGATACAAGGTGTG[G/A]GTCCGTGTCAAACCGGACGGCGTTTCTTATAAAGGCTACTGGAGTTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064033 Nonsense 346 509 8 8
Genomic Location (Zv9):
Chromosome 3 (position 14158269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14410752
KASP Assay ID:
554-0049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATTAGACGAGAGGAAGCTTGTGCGGGACGAGGACCAGCGTTCAGACT[C/A]GGGGCTGACAGAGCCTCCTCATTGGCTCATGGAGCAGCTGAGGGCGCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link