rab3db

Ensembl ID:
ENSDARG00000043607
ZFIN ID:
ZDB-GENE-040718-428
Description:
ras-related protein Rab-3B [Source:RefSeq peptide;Acc:NP_001002679]
Human Orthologue:
RAB3D
Human Description:
RAB3D, member RAS oncogene family [Source:HGNC Symbol;Acc:9779]
Mouse Orthologue:
Rab3d
Mouse Description:
RAB3D, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064031 Nonsense 118 220 4 5
Genomic Location:
Chromosome 3 (position 13569663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTNAATACTGATTGAGAGTGTTTAGTGTTTCTGTCCYGACTGTGTAG[G/A]GCCACGCAGATCAAGACGTACTCGTGGGACAAYGCTCAGGTGATTCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rdjv1b7x