tmem205

Ensembl ID:
ENSDARG00000043604
ZFIN ID:
ZDB-GENE-070112-1692
Description:
Transmembrane protein 205 [Source:UniProtKB/Swiss-Prot;Acc:A1L2F6]
Human Orthologue:
TMEM205
Human Description:
transmembrane protein 205 [Source:HGNC Symbol;Acc:29631]
Mouse Orthologue:
Tmem205
Mouse Description:
transmembrane protein 205 Gene [Source:MGI Symbol;Acc:MGI:3045495]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40012 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7317 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6148 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5190 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40011 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Essential Splice Site None 188 None 4
ENSDART00000137099 Essential Splice Site None 188 None 4
ENSDART00000139990 Essential Splice Site None 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13605234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGATTAACCCAAACTGATCACACAGAACCAGGCGTAGAGCGACCGGG[T/A]ATGTATTTTCTATAAACCGACAGAGTTTACAGTTGGAGGGAAATTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028   None 188 None 4
ENSDART00000137099   None 188 None 4
ENSDART00000139990 Essential Splice Site None 188 2 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13604440)
KASP Assay ID:
554-4390.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCAACTWTTCCAGCATTTGTTTTACGCAGTGGATGGCCTTCCAGCCG[T/C]AAGKCAGTACTGGAAAACACCTATAAACACTCATTCTCNNNNACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028   None 188 None 4
ENSDART00000137099 Essential Splice Site None 188 2 4
ENSDART00000139990   None 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13601667)
KASP Assay ID:
554-3769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTTTGAGGTTTTAATCTTAATTAAATTGCTTCTTTTTCTATTTATA[G/T]AACATTTTTTCTTTACAGAAAGATAATTATGGCTACTGAGGGAGATCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Essential Splice Site 34 188 None 4
ENSDART00000137099 Essential Splice Site 34 188 None 4
ENSDART00000139990 Essential Splice Site 34 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13601537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTTCCTTCACTTGGGGAATGCAGGTGTGGGTGTCTTTCATAGCAGG[T/G]AAGCAAACTTGTATGAAAACTAAACAKAAATRCAGTCGATGCATGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Nonsense 127 188 4 4
ENSDART00000137099 Nonsense 127 188 4 4
ENSDART00000139990 Nonsense 127 188 5 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13597299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGAGAATATGCTGGTCATGCAGGAGATCGAGAAGGAGCACGGTCTG[G/T]GAAATCAAGTGGGCATGAGCTCCAACAGGGAAGGATACACCAAACTGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link