tmem205

Ensembl ID:
ENSDARG00000043604
ZFIN ID:
ZDB-GENE-070112-1692
Description:
Transmembrane protein 205 [Source:UniProtKB/Swiss-Prot;Acc:A1L2F6]
Human Orthologue:
TMEM205
Human Description:
transmembrane protein 205 [Source:HGNC Symbol;Acc:29631]
Mouse Orthologue:
Tmem205
Mouse Description:
transmembrane protein 205 Gene [Source:MGI Symbol;Acc:MGI:3045495]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7317 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6148 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5190 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 None None 188 None 4
ENSDART00000137099 None None 188 None 4
ENSDART00000139990 Essential Splice Site None 188 2 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13604440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCAACTWTTCCAGCATTTGTTTTACGCAGTGGATGGCCTTCCAGCCG[T/C]AAGKCAGTACTGGAAAACACCTATAAACACTCATTCTCNNNNACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 None None 188 None 4
ENSDART00000137099 Essential Splice Site None 188 2 4
ENSDART00000139990 None None 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13601667)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTTTGAGGTTTTAATCTTAATTAAATTGCTTCTTTTTCTATTTATA[G/T]AACATTTTTTCTTTACAGAAAGATAATTATGGCTACTGAGGGAGATCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Essential Splice Site 34 188 None 4
ENSDART00000137099 Essential Splice Site 34 188 None 4
ENSDART00000139990 Essential Splice Site 34 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 13601537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTTCCTTCACTTGGGGAATGCAGGTGTGGGTGTCTTTCATAGCAGG[T/G]AAGCAAACTTGTATGAAAACTAAACAKAAATRCAGTCGATGCATGCCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eg9kxwe6