tmem205

Ensembl ID:: ENSDARG00000043604
ZFIN ID:: ZDB-GENE-070112-1692
Description:: Transmembrane protein 205 [Source:UniProtKB/Swiss-Prot;Acc:A1L2F6]
Human Orthologue:: TMEM205
Human Description:: transmembrane protein 205 [Source:HGNC Symbol;Acc:29631]
Mouse Orthologue:: Tmem205
Mouse Description:: transmembrane protein 205 Gene [Source:MGI Symbol;Acc:MGI:3045495]

Alleles

There are 3 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa7317	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa6148	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa5190	Essential Splice Site	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa7317
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000064028		None	188	None	4
ENSDART00000137099		None	188	None	4
ENSDART00000139990	Essential Splice Site	None	188	2	5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

ENSDART00000144081

Genomic Location:: Chromosome 3 (position 13604440)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CCGCCAACTWTTCCAGCATTTGTTTTACGCAGTGGATGGCCTTCCAGCCG[T/C]AAGKCAGTACTGGAAAACACCTATAAACACTCATTCTCNNNNACACACACACAC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa6148
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000064028		None	188	None	4
ENSDART00000137099	Essential Splice Site	None	188	2	4
ENSDART00000139990		None	188	None	5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

ENSDART00000144081

Genomic Location:: Chromosome 3 (position 13601667)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TGCTCTTTGAGGTTTTAATCTTAATTAAATTGCTTCTTTTTCTATTTATA[G/T]AACATTTTTTCTTTACAGAAAGATAATTATGGCTACTGAGGGAGATCCGA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5190
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000064028	Essential Splice Site	34	188	None	4
ENSDART00000137099	Essential Splice Site	34	188	None	4
ENSDART00000139990	Essential Splice Site	34	188	None	5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

ENSDART00000144081

Genomic Location:: Chromosome 3 (position 13601537)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GTGATTTCCTTCACTTGGGGAATGCAGGTGTGGGTGTCTTTCATAGCAGG[T/G]AAGCAAACTTGTATGAAAACTAAACAKAAATRCAGTCGATGCATGCCATG
Associated Phenotype:: Not determined

OMIM

OMIM information for TMEM205

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: