
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem205
- Ensembl ID:
- ENSDARG00000043604
- ZFIN ID:
- ZDB-GENE-070112-1692
- Description:
- Transmembrane protein 205 [Source:UniProtKB/Swiss-Prot;Acc:A1L2F6]
- Human Orthologue:
- TMEM205
- Human Description:
- transmembrane protein 205 [Source:HGNC Symbol;Acc:29631]
- Mouse Orthologue:
- Tmem205
- Mouse Description:
- transmembrane protein 205 Gene [Source:MGI Symbol;Acc:MGI:3045495]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40012 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa7317 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6148 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa40011 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40012
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064028 | Essential Splice Site | None | 188 | None | 4 |
ENSDART00000137099 | Essential Splice Site | None | 188 | None | 4 |
ENSDART00000139990 | Essential Splice Site | None | 188 | None | 5 |
The following transcripts of ENSDARG00000043604 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 13605234)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 14349390 GRCz11 3 14499190 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGGATTAACCCAAACTGATCACACAGAACCAGGCGTAGAGCGACCGGG[T/A]ATGTATTTTCTATAAACCGACAGAGTTTACAGTTGGAGGGAAATTGCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7317
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064028 | None | 188 | None | 4 | |
ENSDART00000137099 | None | 188 | None | 4 | |
ENSDART00000139990 | Essential Splice Site | None | 188 | 2 | 5 |
The following transcripts of ENSDARG00000043604 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 13604440)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 14350184 GRCz11 3 14499984 - KASP Assay ID:
- 554-4390.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGCCAACTWTTCCAGCATTTGTTTTACGCAGTGGATGGCCTTCCAGCCG[T/C]AAGKCAGTACTGGAAAACACCTATAAACACTCATTCTCNNNNACACACACACAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6148
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064028 | None | 188 | None | 4 | |
ENSDART00000137099 | Essential Splice Site | None | 188 | 2 | 4 |
ENSDART00000139990 | None | 188 | None | 5 |
The following transcripts of ENSDARG00000043604 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 13601667)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 14352957 GRCz11 3 14502757 - KASP Assay ID:
- 554-3769.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTCTTTGAGGTTTTAATCTTAATTAAATTGCTTCTTTTTCTATTTATA[G/T]AACATTTTTTCTTTACAGAAAGATAATTATGGCTACTGAGGGAGATCCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40011
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064028 | Nonsense | 127 | 188 | 4 | 4 |
ENSDART00000137099 | Nonsense | 127 | 188 | 4 | 4 |
ENSDART00000139990 | Nonsense | 127 | 188 | 5 | 5 |
The following transcripts of ENSDARG00000043604 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 3 (position 13597299)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 14357325 GRCz11 3 14507125 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACAGAGAATATGCTGGTCATGCAGGAGATCGAGAAGGAGCACGGTCTG[G/T]GAAATCAAGTGGGCATGAGCTCCAACAGGGAAGGATACACCAAACTGCGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: