elof1

Ensembl ID:
ENSDARG00000043601
ZFIN ID:
ZDB-GENE-040426-1385
Description:
transcription elongation factor 1 homolog [Source:RefSeq peptide;Acc:NP_956680]
Human Orthologue:
ELOF1
Human Description:
elongation factor 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28691]
Mouse Orthologues:
AC127331.1, AC127331.2, Elof1, Gm10525, Gm10526, Gm10527, Gm10528
Mouse Descriptions:
elongation factor 1 homolog (ELF1, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913376]
predicted gene 10525 Gene [Source:MGI Symbol;Acc:MGI:3641771]
predicted gene 10526 Gene [Source:MGI Symbol;Acc:MGI:3641768]
predicted gene 10527 Gene [Source:MGI Symbol;Acc:MGI:3641767]
predicted gene 10528 Gene [Source:MGI Symbol;Acc:MGI:3642526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11344 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064025 Splice Site, Nonsense 63 83 4 4
Genomic Location:
Chromosome 3 (position 13607147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTGATGTCTAATGTTGTTGTGTTTTTGTCCTYAACTTAMCTGCCAGA[T/A]CTCTCGGAGCCGGTGGAYGTGTACAGCGATTGGATAGATGCTTGTGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/70w6ejj4