si:ch211-127h20.2

Ensembl ID:
ENSDARG00000043593
ZFIN ID:
ZDB-GENE-081105-26
Description:
Novel protein similar to vertebrate Rap guanine nucleotide exchange factor (GEF) 1 (RAPGEF1) [Source
Human Orthologue:
RAPGEF1
Human Description:
Rap guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:4568]
Mouse Orthologue:
Rapgef1
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:104580]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14124 Nonsense Available for shipment Available now
sa41138 Nonsense Mutation detected in F1 DNA During 2017
sa17359 Essential Splice Site Available for shipment Available now
sa10846 Nonsense Available for shipment Available now
sa18908 Nonsense Mutation detected in F1 DNA During 2017
sa34334 Nonsense Mutation detected in F1 DNA During 2017
sa27140 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 249 1085 6 25
ENSDART00000139947 Nonsense 241 1077 5 24
Genomic Location (Zv9):
Chromosome 8 (position 12348729)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11793492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGAAGTAGCCCCTCCGAAACCCCCTCTACCTGGACTCAAAGTGCCT[G/T]AACAACACTGGTACKTAAGCTTTACTTGRCTTTCACCACAATAACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 250 1085 6 25
ENSDART00000139947 Nonsense 242 1077 5 24
Genomic Location (Zv9):
Chromosome 8 (position 12348726)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11793489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGTAGCCCCTCCGAAACCCCCTCTACCTGGACTCAAAGTGCCTGAA[C/T]AACACTGGTACGTAAGCTTTACTTGACTTTCACCACAATAACATTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Essential Splice Site 480 1085 9 25
ENSDART00000139947 Essential Splice Site 472 1077 8 24
Genomic Location (Zv9):
Chromosome 8 (position 12335117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11779880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCAGATCCCCCAGAGCCCCCCACCCCTGCCGGAGAAGAAGAGTCGCCAKA[G/T]TGAGTATAAAGAATTCAGAWGGGTTGTTTAGAGGAYTGCAAATCACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
Genomic Location (Zv9):
Chromosome 8 (position 12317643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11762406
KASP Assay ID:
2260-0229.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGCCTGCCTGTGCTTKTGCTGTCCTCCCTCTTGTTTTYCTGTAGAGC[G/T]AAAGTGCTAATGATGAAGGTGGGGAGGGTGAATACGTCAATCTGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
Genomic Location (Zv9):
Chromosome 8 (position 12317643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11762406
KASP Assay ID:
2260-0229.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGCCTGCCTGTGCTTGTGCTGTCCTCCCTCTTGTTTTTCTGTAGAGC[G/T]AAAGTGCTAATGATGAAGGTGGGGAGGGTGAATACGTCAATCTGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 693 1085 14 25
ENSDART00000139947 Nonsense 685 1077 13 24
Genomic Location (Zv9):
Chromosome 8 (position 12310120)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11754883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTGATTGACCACGATGAGATCATGTCTCGCATAACACTAAAGCAA[G/T]AGGTAAACTTTTGCGTTCGTTATTGCATACAGTATGCACATATACAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Essential Splice Site 993 1085 24 25
ENSDART00000139947 Essential Splice Site 985 1077 23 24
Genomic Location (Zv9):
Chromosome 8 (position 12299057)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11743820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGCTGTCATGTTCTGTGTGTAATGTTCCTATGTTTCCACAAAATGC[A/T]GAGGTCTCATCCTCCAGGACTTAACGTTTGTGCATCTTGGGAATCCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link